class Bio::Sequence

DESCRIPTION¶ ↑

Bio::Sequence objects represent annotated sequences in bioruby. A Bio::Sequence object is a wrapper around the actual sequence, represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. For most users, this encapsulation will be completely transparent. Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA objects using the same arguments and returning the same values (even though these methods are not documented specifically for Bio::Sequence).

USAGE¶ ↑

# Create a nucleic or amino acid sequence
dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU')

# Print it out
puts dna.to_s
puts aa.to_s

# Get a subsequence, bioinformatics style (first nucleotide is '1')
puts dna.subseq(2,6)

# Get a subsequence, informatics style (first nucleotide is '0')
puts dna[2,6]

# Print in FASTA format
puts dna.output(:fasta)

# Print all codons
dna.window_search(3,3) do |codon|
  puts codon
end

# Splice or otherwise mangle your sequence
puts dna.splicing("complement(join(1..5,16..20))")
puts rna.splicing("complement(join(1..5,16..20))")

# Convert a sequence containing ambiguity codes into a
# regular expression you can use for subsequent searching
puts aa.to_re

# These should speak for themselves
puts dna.complement
puts dna.composition
puts dna.molecular_weight
puts dna.translate
puts dna.gc_percent

Attributes

classification [RW]

Organism classification, taxonomic classification of the source organism. (Array of String)

comments [RW]

Comments (String or an Array of String)

data_class [RW]

Data Class defined by EMBL (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_1

date_created [RW]

Created date of the sequence entry (Date, DateTime, Time, or String)

date_modified [RW]

Last modified date of the sequence entry (Date, DateTime, Time, or String)

dblinks [RW]

Links to other database entries. (An Array of Bio::Sequence::DBLink objects)

definition [RW]

A String with a description of the sequence (String)

division [RW]

Taxonomic Division defined by EMBL/GenBank/DDBJ (String) See www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_2

entry_id [RW]

The sequence identifier (String). For example, for a sequence of Genbank origin, this is the locus name. For a sequence of EMBL origin, this is the primary accession number.

entry_version [RW]

Version of the entry (String or Integer). Unlike sequence_version, entry_version is a database maintainer’s internal version number. The version number will be changed when the database maintainer modifies the entry. The same enrty in EMBL, GenBank, and DDBJ may have different entry_version.

error_probabilities [RW]

Error probabilities of the bases/residues in the sequence. (Array containing Float, or nil)

features [RW]

Features (An Array of Bio::Feature objects)

id_namespace [RW]

Namespace of the sequence IDs described in entry_id, primary_accession, and secondary_accessions methods (String). For example, ‘EMBL’, ‘GenBank’, ‘DDBJ’, ‘RefSeq’.

keywords [RW]

Keywords (An Array of String)

molecule_type [RW]

molecular type (String). “DNA” or “RNA” for nucleotide sequence.

moltype [RW]

Bio::Sequence::NA/AA

organelle [RW]

(not well supported) Organelle information (String).

other_seqids [RW]

Sequence identifiers which are not described in entry_id, primary_accession,and secondary_accessions methods (Array of Bio::Sequence::DBLink objects). For example, NCBI GI number can be stored. Note that only identifiers of the entry itself should be stored. For database cross references, dblinks should be used.

primary_accession [RW]

Primary accession number (String)

quality_score_type [RW]

The meaning (calculation method) of the quality scores stored in the quality_scores attribute. Maybe one of :phred, :solexa, or nil.

Note that if it is nil, and error_probabilities is empty, some methods implicitly assumes that it is :phred (PHRED score).

quality_scores [RW]

Quality scores of the bases/residues in the sequence. (Array containing Integer, or nil)

references [RW]

References (An Array of Bio::Reference objects)

release_created [RW]

Release information when created (String)

release_modified [RW]

Release information when last-modified (String)

secondary_accessions [RW]

Secondary accession numbers (Array of String)

seq [RW]

The sequence object, usually Bio::Sequence::NA/AA, but could be a simple String

sequence_version [RW]

Version number of the sequence (String or Integer). Unlike entry_version, sequence_version will be changed when the submitter of the sequence updates the entry. Normally, the same entry taken from different databases (EMBL, GenBank, and DDBJ) may have the same sequence_version.

species [RW]

Organism species (String). For example, “Escherichia coli”.

strandedness [RW]

Strandedness (String). “single” (single-stranded), “double” (double-stranded), “mixed” (mixed-stranded), or nil.

taxonomy [RW]

Organism classification, taxonomic classification of the source organism. (Array of String)

topology [RW]

Topology (String). “circular”, “linear”, or nil.

Public Class Methods

adapter (source_data, adapter_module)

Source

    # File lib/bio/sequence.rb
463 def self.adapter(source_data, adapter_module)
464   biosequence = self.new(nil)
465   biosequence.instance_eval {
466     remove_instance_variable(:@seq)
467     @source_data = source_data
468   }
469   biosequence.extend(adapter_module)
470   biosequence
471 end

Normally, users should not call this method directly. Use Bio::*#to_biosequence (e.g. Bio::GenBank#to_biosequence).

Creates a new Bio::Sequence object from database data with an adapter module.

auto (str)

Source

    # File lib/bio/sequence.rb
283 def self.auto(str)
284   seq = self.new(str)
285   seq.auto
286   return seq
287 end

Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and return a new Bio::Sequence object wrapping a sequence of the guessed type (either Bio::Sequence::AA or Bio::Sequence::NA)

s = Bio::Sequence.auto('atgc')
puts s.seq.class                        #=> Bio::Sequence::NA

Arguments:

(required) str: String or Bio::Sequence::NA/AA object

Returns: Bio::Sequence object

guess (str, *args)

Source

    # File lib/bio/sequence.rb
381 def self.guess(str, *args)
382   self.new(str).guess(*args)
383 end

Guess the class of a given sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.

puts .guess('atgc')        #=> Bio::Sequence::NA

There are three optional parameters: ‘threshold`, `length`, and `index`.

The ‘threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA “guess”. In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.

puts Bio::Sequence.guess('atgcatgcqq')      #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA

The ‘length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.

# limit the guess to the first 1000 positions
puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000)

The ‘index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…

puts Bio::Sequence.guess('-----atgcc')             #=> Bio::Sequence::AA
puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA

Arguments:

(required) str: String or Bio::Sequence::NA/AA object
(optional) threshold: Float in range 0,1 (default 0.9)
(optional) length: Fixnum (default 10000)
(optional) index: Fixnum (default 1)

Returns: Bio::Sequence::NA/AA

input (str, format = nil)

Source

    # File lib/bio/sequence.rb
436 def self.input(str, format = nil)
437   if format then
438     klass = format
439   else
440     klass = Bio::FlatFile::AutoDetect.default.autodetect(str)
441   end
442   obj = klass.new(str)
443   obj.to_biosequence
444 end

Create a new Bio::Sequence object from a formatted string (GenBank, EMBL, fasta format, etc.)

s = Bio::Sequence.input(str)

Arguments:

(required) str: string
(optional) format: format specification (class or nil)

Returns: Bio::Sequence object

new (str)

Source

    # File lib/bio/sequence.rb
 99 def initialize(str)
100   @seq = str
101 end

Create a new Bio::Sequence object

s = Bio::Sequence.new('atgc')
puts s                                  #=> 'atgc'

Note that this method does not intialize the contained sequence as any kind of bioruby object, only as a simple string

puts s.seq.class                        #=> String

See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto for methods to transform the basic String of a just created Bio::Sequence object to a proper bioruby object

Arguments:

(required) str: String or Bio::Sequence::NA/AA object

Returns: Bio::Sequence object

read (str, format = nil)

Source

    # File lib/bio/sequence.rb
447 def self.read(str, format = nil)
448   input(str, format)
449 end

alias of Bio::Sequence.input

Public Instance Methods

aa ()

Source

    # File lib/bio/sequence.rb
422 def aa
423   @seq = AA.new(seq)
424   @moltype = AA
425 end

Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!

s = Bio::Sequence.new('atgc')
puts s.seq.class                        #=> String
s.aa
puts s.seq.class                        #=> Bio::Sequence::AA !!!

However, if you know your sequence type, this method may be constructively used after initialization,

s = Bio::Sequence.new('RRLE')
s.aa

Returns: Bio::Sequence::AA

accessions ()

Source

    # File lib/bio/sequence.rb
454 def accessions
455   [ primary_accession, secondary_accessions ].flatten.compact
456 end

accession numbers of the sequence

Returns: Array of String

auto ()

Source

    # File lib/bio/sequence.rb
264 def auto
265   @moltype = guess
266   if @moltype == NA
267     @seq = NA.new(seq)
268   else
269     @seq = AA.new(seq)
270   end
271 end

Guess the type of sequence, Amino Acid or Nucleic Acid, and create a new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis of this guess. This method will change the current Bio::Sequence object.

s = Bio::Sequence.new('atgc')
puts s.seq.class                        #=> String
s.auto
puts s.seq.class                        #=> Bio::Sequence::NA

Returns: Bio::Sequence::NA/AA object

guess (threshold = 0.9, length = 10000, index = 0)

Source

    # File lib/bio/sequence.rb
328 def guess(threshold = 0.9, length = 10000, index = 0)
329   str = seq.to_s[index,length].to_s.extend Bio::Sequence::Common
330   cmp = str.composition
331 
332   bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] +
333           cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u']
334 
335   total = str.length - cmp['N'] - cmp['n']
336 
337   if bases.to_f / total > threshold
338     return NA
339   else
340     return AA
341   end
342 end

Guess the class of the current sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.

s = Bio::Sequence.new('atgc')
puts s.guess                            #=> Bio::Sequence::NA

There are three parameters: ‘threshold`, `length`, and `index`.

s = Bio::Sequence.new('atgcatgcqq')
puts s.guess                            #=> Bio::Sequence::AA
puts s.guess(0.8)                       #=> Bio::Sequence::AA
puts s.guess(0.7)                       #=> Bio::Sequence::NA

The ‘length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.

s = Bio::Sequence.new(A VERY LONG SEQUENCE)
puts s.guess(0.9, 1000)  # limit the guess to the first 1000 positions

The ‘index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…

s = Bio::Sequence.new('-----atgcc')
puts s.guess                            #=> Bio::Sequence::AA
puts s.guess(0.9,10000,5)               #=> Bio::Sequence::NA

Arguments:

(optional) threshold: Float in range 0,1 (default 0.9)
(optional) length: Fixnum (default 10000)
(optional) index: Fixnum (default 1)

Returns: Bio::Sequence::NA/AA

na ()

Source

    # File lib/bio/sequence.rb
401 def na
402   @seq = NA.new(seq)
403   @moltype = NA
404 end

s = Bio::Sequence.new('RRLE')
puts s.seq.class                        #=> String
s.na
puts s.seq.class                        #=> Bio::Sequence::NA !!!

However, if you know your sequence type, this method may be constructively used after initialization,

s = Bio::Sequence.new('atgc')
s.na

Returns: Bio::Sequence::NA

to_s ()

Source

   # File lib/bio/sequence/compat.rb
27 def to_s
28   String.new(self.seq)
29 end

Return sequence as String. The original sequence is unchanged.

seq = Bio::Sequence.new('atgc')
puts s.to_s                             #=> 'atgc'
puts s.to_s.class                       #=> String
puts s                                  #=> 'atgc'
puts s.class                            #=> Bio::Sequence

Returns: String object

Also aliased as: to_str

to_str ()

Alias for: to_s