class Bio::Sequence


Bio::Sequence objects represent annotated sequences in bioruby. A Bio::Sequence object is a wrapper around the actual sequence, represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. For most users, this encapsulation will be completely transparent. Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA objects using the same arguments and returning the same values (even though these methods are not documented specifically for Bio::Sequence).


# Create a nucleic or amino acid sequence
dna ='atgcatgcATGCATGCAAAA')
rna ='augcaugcaugcaugcaaaa')

# Print it out
puts dna.to_s
puts aa.to_s

# Get a subsequence, bioinformatics style (first nucleotide is '1')
puts dna.subseq(2,6)

# Get a subsequence, informatics style (first nucleotide is '0')
puts dna[2,6]

# Print in FASTA format
puts dna.output(:fasta)

# Print all codons
dna.window_search(3,3) do |codon|
  puts codon

# Splice or otherwise mangle your sequence
puts dna.splicing("complement(join(1..5,16..20))")
puts rna.splicing("complement(join(1..5,16..20))")

# Convert a sequence containing ambiguity codes into a 
# regular expression you can use for subsequent searching
puts aa.to_re

# These should speak for themselves
puts dna.complement
puts dna.composition
puts dna.molecular_weight
puts dna.translate
puts dna.gc_percent



Organism classification, taxonomic classification of the source organism. (Array of String)


Comments (String or an Array of String)


Created date of the sequence entry (Date, DateTime, Time, or String)


Last modified date of the sequence entry (Date, DateTime, Time, or String)


A String with a description of the sequence (String)


Taxonomic Division defined by EMBL/GenBank/DDBJ (String) See


The sequence identifier (String). For example, for a sequence of Genbank origin, this is the locus name. For a sequence of EMBL origin, this is the primary accession number.


Version of the entry (String or Integer). Unlike sequence_version, entry_version is a database maintainer's internal version number. The version number will be changed when the database maintainer modifies the entry. The same enrty in EMBL, GenBank, and DDBJ may have different entry_version.


Error probabilities of the bases/residues in the sequence. (Array containing Float, or nil)


Features (An Array of Bio::Feature objects)


Namespace of the sequence IDs described in #entry_id, #primary_accession, and #secondary_accessions methods (String). For example, 'EMBL', 'GenBank', 'DDBJ', 'RefSeq'.


Keywords (An Array of String)


molecular type (String). “DNA” or “RNA” for nucleotide sequence.




(not well supported) Organelle information (String).


Sequence identifiers which are not described in #entry_id, #primary_accession,and #secondary_accessions methods (Array of Bio::Sequence::DBLink objects). For example, NCBI GI number can be stored. Note that only identifiers of the entry itself should be stored. For database cross references, dblinks should be used.


Primary accession number (String)


The meaning (calculation method) of the quality scores stored in the quality_scores attribute. Maybe one of :phred, :solexa, or nil.

Note that if it is nil, and error_probabilities is empty, some methods implicitly assumes that it is :phred (PHRED score).


Quality scores of the bases/residues in the sequence. (Array containing Integer, or nil)


References (An Array of Bio::Reference objects)


Release information when created (String)


Release information when last-modified (String)


Secondary accession numbers (Array of String)


The sequence object, usually Bio::Sequence::NA/AA, but could be a simple String


Version number of the sequence (String or Integer). Unlike entry_version, sequence_version will be changed when the submitter of the sequence updates the entry. Normally, the same entry taken from different databases (EMBL, GenBank, and DDBJ) may have the same sequence_version.


Organism species (String). For example, “Escherichia coli”.


Strandedness (String). “single” (single-stranded), “double” (double-stranded), “mixed” (mixed-stranded), or nil.


Organism classification, taxonomic classification of the source organism. (Array of String)


Topology (String). “circular”, “linear”, or nil.

Public Class Methods

adapter(source_data, adapter_module) click to toggle source

Normally, users should not call this method directly. Use Bio::*#to_biosequence (e.g. Bio::GenBank#to_biosequence).

Creates a new Bio::Sequence object from database data with an adapter module.

# File lib/bio/sequence.rb, line 463
def self.adapter(source_data, adapter_module)
  biosequence =
  biosequence.instance_eval {
    @source_data = source_data
auto(str) click to toggle source

Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and return a new Bio::Sequence object wrapping a sequence of the guessed type (either Bio::Sequence::AA or Bio::Sequence::NA)

s ='atgc')
puts s.seq.class                        #=> Bio::Sequence::NA


  • (required) str: String or Bio::Sequence::NA/AA object


Bio::Sequence object

# File lib/bio/sequence.rb, line 283
  seq =
  return seq
guess(str, *args) click to toggle source

Guess the class of a given sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.

puts .guess('atgc')        #=> Bio::Sequence::NA

There are three optional parameters: `threshold`, `length`, and `index`.

The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA “guess”. In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.

puts Bio::Sequence.guess('atgcatgcqq')      #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA
puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA

The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.

# limit the guess to the first 1000 positions
puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000)

The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…

puts Bio::Sequence.guess('-----atgcc')             #=> Bio::Sequence::AA
puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA


  • (required) str: String or Bio::Sequence::NA/AA object

  • (optional) threshold: Float in range 0,1 (default 0.9)

  • (optional) length: Fixnum (default 10000)

  • (optional) index: Fixnum (default 1)



# File lib/bio/sequence.rb, line 381
def self.guess(str, *args)*args)
input(str, format = nil) click to toggle source

Create a new Bio::Sequence object from a formatted string (GenBank, EMBL, fasta format, etc.)

s = Bio::Sequence.input(str)


  • (required) str: string

  • (optional) format: format specification (class or nil)


Bio::Sequence object

# File lib/bio/sequence.rb, line 436
def self.input(str, format = nil)
  if format then
    klass = format
    klass = Bio::FlatFile::AutoDetect.default.autodetect(str)
  obj =
new(str) click to toggle source

Create a new Bio::Sequence object

s ='atgc')
puts s                                  #=> 'atgc'

Note that this method does not intialize the contained sequence as any kind of bioruby object, only as a simple string

puts s.seq.class                        #=> String

See #na, #aa, and #auto for methods to transform the basic String of a just created Bio::Sequence object to a proper bioruby object


  • (required) str: String or Bio::Sequence::NA/AA object


Bio::Sequence object

# File lib/bio/sequence.rb, line 99
def initialize(str)
  @seq = str
read(str, format = nil) click to toggle source

alias of ::input

# File lib/bio/sequence.rb, line 447
def, format = nil)
  input(str, format)

Public Instance Methods

aa() click to toggle source

Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!

s ='atgc')
puts s.seq.class                        #=> String
puts s.seq.class                        #=> Bio::Sequence::AA !!!

However, if you know your sequence type, this method may be constructively used after initialization,

s ='RRLE')



# File lib/bio/sequence.rb, line 422
def aa
  @seq =
  @moltype = AA
accessions() click to toggle source

accession numbers of the sequence


Array of String

# File lib/bio/sequence.rb, line 454
def accessions
  [ primary_accession, secondary_accessions ].flatten.compact
auto() click to toggle source

Guess the type of sequence, Amino Acid or Nucleic Acid, and create a new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis of this guess. This method will change the current Bio::Sequence object.

s ='atgc')
puts s.seq.class                        #=> String
puts s.seq.class                        #=> Bio::Sequence::NA


Bio::Sequence::NA/AA object

# File lib/bio/sequence.rb, line 264
def auto
  @moltype = guess
  if @moltype == NA
    @seq =
    @seq =
guess(threshold = 0.9, length = 10000, index = 0) click to toggle source

Guess the class of the current sequence. Returns the class (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by developers only, but if you know what you are doing, feel free.

s ='atgc')
puts s.guess                            #=> Bio::Sequence::NA

There are three parameters: `threshold`, `length`, and `index`.

The `threshold` value (defaults to 0.9) is the frequency of nucleic acid bases [AGCTUagctu] required in the sequence for this method to produce a Bio::Sequence::NA “guess”. In the default case, if less than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], then the guess is Bio::Sequence::AA.

s ='atgcatgcqq')
puts s.guess                            #=> Bio::Sequence::AA
puts s.guess(0.8)                       #=> Bio::Sequence::AA
puts s.guess(0.7)                       #=> Bio::Sequence::NA

The `length` value is how much of the total sequence to use in the guess (default 10000). If your sequence is very long, you may want to use a smaller amount to reduce the computational burden.

puts s.guess(0.9, 1000)  # limit the guess to the first 1000 positions

The `index` value is where to start the guess. Perhaps you know there are a lot of gaps at the start…

s ='-----atgcc')
puts s.guess                            #=> Bio::Sequence::AA
puts s.guess(0.9,10000,5)               #=> Bio::Sequence::NA


  • (optional) threshold: Float in range 0,1 (default 0.9)

  • (optional) length: Fixnum (default 10000)

  • (optional) index: Fixnum (default 1)



# File lib/bio/sequence.rb, line 328
def guess(threshold = 0.9, length = 10000, index = 0)
  str = seq.to_s[index,length].to_s.extend Bio::Sequence::Common
  cmp = str.composition

  bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] +
          cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u']

  total = str.length - cmp['N'] - cmp['n']

  if bases.to_f / total > threshold
    return NA
    return AA
na() click to toggle source

Transform the sequence wrapped in the current Bio::Sequence object into a Bio::Sequence::NA object. This method will change the current object. This method does not validate your choice, so be careful!

s ='RRLE')
puts s.seq.class                        #=> String
puts s.seq.class                        #=> Bio::Sequence::NA !!!

However, if you know your sequence type, this method may be constructively used after initialization,

s ='atgc')



# File lib/bio/sequence.rb, line 401
def na
  @seq =
  @moltype = NA
to_s() click to toggle source

Return sequence as String. The original sequence is unchanged.

seq ='atgc')
puts s.to_s                             #=> 'atgc'
puts s.to_s.class                       #=> String
puts s                                  #=> 'atgc'
puts s.class                            #=> Bio::Sequence


String object

# File lib/bio/sequence/compat.rb, line 27
def to_s
Also aliased as: to_str
Alias for: to_s